Top » Catalog » R1b » A1371

$18.00

A1371
[A1371]

A1371
hg38 Position: ChrY:16080025..16080025
Ancestral: G
Derived: T
Reference: Desideriu Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1371_F TTCAACTAACAACTTCTACTGAGGACG
Reverse Primer: A1371_R GGACACAGAGCGCTGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A903
$18.00
Haplogroup Info
Other products
Currencies