Top » Catalog » R1b » A1371

$18.00

A1371
[A1371]

A1371
hg38 Position: ChrY:16080025..16080025
Ancestral: G
Derived: T
Reference: Desideriu Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1371_F TTCAACTAACAACTTCTACTGAGGACG
Reverse Primer: A1371_R GGACACAGAGCGCTGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2149
1 x A55
1 x A605
1 x A1494
1 x A1081
1 x A1159
1 x A461
1 x A742
1 x A996
1 x A750
1 x A542
1 x A208
1 x A1097
1 x A744
1 x A888
$270.00
Haplogroup Info
Other products
Currencies