Top » Catalog » R1b » A37

$18.00

A37
[A37]

A37
hg38 Position: ChrY:16543557..16543557
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A37_F CCACACCACATTCTCATTCC
Reverse Primer: A37_R ATCCCAGAGTGAGGGGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14645
1 x A20817
1 x A19334
1 x A19281
1 x A19277
1 x A13641
1 x A15553
1 x A17831
1 x A12925
1 x A14644
1 x A13647
1 x A18932
1 x A19279
1 x A20820
1 x A19274
1 x A18468
1 x A15547
1 x A12921
1 x A15548
1 x A13649
1 x A18931
1 x A19931
1 x A17372
1 x A13639
1 x A12919
1 x A19275
1 x A10970
1 x A13645
1 x A14648
1 x A18555
1 x A19336
1 x A20954
1 x A13638
1 x A19929
1 x A18940
1 x A14641
1 x A15551
1 x A17833
1 x A19335
1 x A13637
1 x A18939
1 x A14639
1 x A12918
1 x A19218
1 x A16982
1 x A19280
1 x A19263
1 x A21955
1 x A15550
1 x A18554
1 x A13633
1 x A13635
1 x A13650
$954.00
Haplogroup Info
Other products
Currencies