Top » Catalog » R1b » A37

$18.00

A37
[A37]

A37
hg38 Position: ChrY:16543557..16543557
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A37_F CCACACCACATTCTCATTCC
Reverse Primer: A37_R ATCCCAGAGTGAGGGGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies