Top » Catalog » R1b » A40

$18.00

A40
[A40]

A40
hg38 Position: ChrY:8231047..8231047
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5
Comments: Found in a R1b-DF41 person
Forward Primer: A40_F GGAAAGGAGACACCTGGAAATG
Reverse Primer: A40_R TGCAGAATTTGGGCTGTTATATG
Reviews

Customers who bought this product also purchased
A98
A98
FGC13023
FGC13023
L1335
L1335
BY23955
BY23955
Z39589
Z39589
BY23827
BY23827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
1 x A2265
1 x A1540
1 x A963
1 x A19
1 x A352
1 x A1324
1 x A2161
1 x A277
1 x A220
$360.00
Haplogroup Info
Other products
Currencies