Top » Catalog » R1b » A41

$18.00

A41
[A41]

A41
hg38 Position: ChrY:8534738..8534738
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A41_F GCCTCATGAATGCACATCAC
Reverse Primer: A41_R AAGCCACATCTGGGAGAGAG
Reviews

Customers who bought this product also purchased
DF41
DF41
S775
S775
FGC5584
FGC5584
Y5638
Y5638
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
MC04
MC04
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies