Top » Catalog » R1b » A41

$18.00

A41
[A41]

A41
hg38 Position: ChrY:8534738..8534738
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A41_F GCCTCATGAATGCACATCAC
Reverse Primer: A41_R AAGCCACATCTGGGAGAGAG
Reviews

Customers who bought this product also purchased
MC21
MC21
Z18014
Z18014
A874
A874
FGC13017
FGC13017
Y5641
Y5641
BY114
BY114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies