Top » Catalog » R1b » A41

$18.00

A41
[A41]

A41
hg38 Position: ChrY:8534738..8534738
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A41_F GCCTCATGAATGCACATCAC
Reverse Primer: A41_R AAGCCACATCTGGGAGAGAG
Reviews

Customers who bought this product also purchased
Y5641
Y5641
BY114
BY114
A100
A100
DF41
DF41
S775
S775
FGC5584
FGC5584
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies