Top » Catalog » R1b » A43

$18.00

A43
[A43]

A43
hg38 Position: ChrY:12222220..12222220
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A43_F TGAAAAATCAAAACTTCTCTTGTGTATAC
Reverse Primer: A43_R GTGGAGGTTGCAGGAAGCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
$162.00
Haplogroup Info
Other products
Currencies