Top » Catalog » R1b » A44

$18.00

A44
[A44]

A44
hg38 Position: ChrY:13435068..13435068
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A44_F ACAGAACATTCTATCCAACAACTG
Reverse Primer: A44_R GGAACGACAGGAATGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A47
1 x A162
1 x A30
1 x A95
1 x A135
1 x A189
1 x A91
1 x A57
1 x A190
1 x A81
1 x A151
1 x A129
1 x A166
1 x A146
1 x A130
1 x A33
1 x A191
1 x A156
1 x A25
1 x A20
1 x A154
1 x A148
1 x A41
1 x A48
1 x A89
1 x A186
1 x A103
1 x A90
1 x A187
1 x A192
1 x A169
1 x A155
1 x A22
1 x A142
1 x A59
1 x A170
1 x A153
1 x A19
1 x A100
1 x A34
1 x A7
1 x A139
1 x A144
1 x A173
1 x A185
1 x A193
1 x A163
1 x A157
1 x A67
1 x A63
1 x A150
1 x A35
1 x A40
1 x A55
$972.00
Haplogroup Info
Other products
Currencies