Top » Catalog » R1b » A44

$18.00

A44
[A44]

A44
hg38 Position: ChrY:13435068..13435068
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A44_F ACAGAACATTCTATCCAACAACTG
Reverse Primer: A44_R GGAACGACAGGAATGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies