Top » Catalog » R1b » A1487

$18.00

A1487
[A1487]

A1487
hg38 Position: ChrY:7123495..7123495
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1487_F TCAATGGGCTATTGGTCCTC
Reverse Primer: A1487_R TCCCTGCTTTGTCTCTCCTC
Reviews

Customers who bought this product also purchased
DF13
DF13
FGC5511
FGC5511
FGC5521
FGC5521
S1088
S1088
S2202
S2202
FGC5496
FGC5496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies