Top » Catalog » R1b » A1487

$18.00

A1487
[A1487]

A1487
hg38 Position: ChrY:7123495..7123495
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1487_F TCAATGGGCTATTGGTCCTC
Reverse Primer: A1487_R TCCCTGCTTTGTCTCTCCTC
Reviews

Customers who bought this product also purchased
DF13
DF13
FGC5539
FGC5539
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
YFS444735
YFS444735
FGC5511
FGC5511
FGC5521
FGC5521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies