Top » Catalog » R1b » A1487

$18.00

A1487
[A1487]

A1487
hg38 Position: ChrY:7123495..7123495
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1487_F TCAATGGGCTATTGGTCCTC
Reverse Primer: A1487_R TCCCTGCTTTGTCTCTCCTC
Reviews

Customers who bought this product also purchased
DF13
DF13
S1088
S1088
S2202
S2202
FGC5496
FGC5496
FGC5539
FGC5539
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
1 x A113
1 x A1758
1 x A818
1 x A531
1 x A2220
1 x A2139
1 x A35
1 x A749
1 x A1369
1 x A773
1 x A1177
1 x A748
1 x A1303
1 x A1289
1 x A1702
$342.00
Haplogroup Info
Other products
Currencies