Top » Catalog » R1b » A1488

$18.00

A1488
[A1488]

A1488
hg38 Position: ChrY:7944675..7944675
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1488vl_F GCAAAGCCACATCACATAGG
Reverse Primer: A1488vl_R GCCATAGGTGGGCTGGTG
Reviews

Customers who bought this product also purchased
A1502
A1502
BY23977
BY23977
A1495
A1495
A1501
A1501
A1509
A1509
A1494
A1494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies