Top » Catalog » R1b » A1489

$18.00

A1489
[A1489]

A1489
hg38 Position: ChrY:8062628..8062628
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1489_F CCTATAATCTGCCTAGAGTGGGTATTC
Reverse Primer: A1489_R TTGTATGGATTCACAATCTTGGC
Reviews

Customers who bought this product also purchased
A1499
A1499
A1504
A1504
A1497
A1497
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2184
1 x A1332
1 x A2248
1 x A1338
1 x A2195
1 x A880
1 x A468
1 x A1240
1 x A1501
1 x A1028
1 x A210
1 x A906
$216.00
Haplogroup Info
Other products
Currencies