Top » Catalog » R1b » A1491

$18.00

A1491
[A1491]

A1491
hg38 Position: ChrY:8577823..8577823
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1491_F TTGAGATGTTGCCTCCACAC
Reverse Primer: A1491_R AGGTAGTCCCATCCAGCAAC
Reviews

Customers who bought this product also purchased
A1501
A1501
A1509
A1509
A1494
A1494
A1500
A1500
A1507
A1507
A1488
A1488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies