Top » Catalog » R1b » A1495

$18.00

A1495
[A1495]

A1495
hg38 Position: ChrY:12615782..12615782
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1495_F GCCCAGCCACTTCAGTTTTC
Reverse Primer: A1495_R TGGCCTTGTCTTTCAGAGTG
Reviews

Customers who bought this product also purchased
A1491
A1491
A1500
A1500
A1507
A1507
A1488
A1488
A1499
A1499
A1506
A1506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A310
1 x A1302
1 x A684
$72.00
Haplogroup Info
Other products
Currencies