Top » Catalog » R1b » A1495

$18.00

A1495
[A1495]

A1495
hg38 Position: ChrY:12615782..12615782
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1495_F GCCCAGCCACTTCAGTTTTC
Reverse Primer: A1495_R TGGCCTTGTCTTTCAGAGTG
Reviews

Customers who bought this product also purchased
A1498
A1498
A1503
A1503
A1496
A1496
A1502
A1502
BY23977
BY23977
A1494
A1494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies