Top » Catalog » R1b » A1497

$18.00

A1497
[A1497]

A1497
hg38 Position: ChrY:14494134..14494134
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1497_F AAGCCACCACACCAAGAAAG
Reverse Primer: A1497_R GGGTTGAGTTTTCCACATGC
Reviews

Customers who bought this product also purchased
A1489
A1489
A1499
A1499
A1504
A1504
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies