Top » Catalog » R1b » A1498

$18.00

A1498
[A1498]

A1498
hg38 Position: ChrY:14744677..14744677
Ancestral: A
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1498_F CAGTGCGCTCTTAGTTCCTC
Reverse Primer: A1498_R CTTCCCATGAAGGCATTGTC
Reviews

Customers who bought this product also purchased
A1509
A1509
A1491
A1491
A1500
A1500
A1507
A1507
A1488
A1488
A1499
A1499
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies