Top » Catalog » R1b » A1500

$18.00

A1500
[A1500]

A1500
hg38 Position: ChrY:15225505..15225505
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1500_F TTGCAGGAGATGCAAAACAC
Reverse Primer: A1500_R TACCACAGCCATTTCCTTTC
Reviews

Customers who bought this product also purchased
A1501
A1501
A1509
A1509
A1491
A1491
A1499
A1499
A1507
A1507
A1488
A1488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A44
1 x A62
1 x A477
1 x A702
1 x A2118
1 x A98
1 x A994
1 x A54
1 x A459
$162.00
Haplogroup Info
Other products
Currencies