Top » Catalog » R1b » A1500

$18.00

A1500
[A1500]

A1500
hg38 Position: ChrY:15225505..15225505
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1500_F TTGCAGGAGATGCAAAACAC
Reverse Primer: A1500_R TACCACAGCCATTTCCTTTC
Reviews

Customers who bought this product also purchased
A1506
A1506
A1496
A1496
A1503
A1503
A1495
A1495
A1502
A1502
BY23977
BY23977
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies