Top » Catalog » R1b » A1501

$18.00

A1501
[A1501]

A1501
hg38 Position: ChrY:17010998..17010998
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1501_F TGTAACAATCATCACTCCCCTTC
Reverse Primer: A1501_R TGCCCTTAGAAATTCTGCATTC
Reviews

Customers who bought this product also purchased
BY23977
BY23977
A1494
A1494
A1500
A1500
A1509
A1509
A1491
A1491
A1499
A1499
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies