Top » Catalog » R1b » A1501

$18.00

A1501
[A1501]

A1501
hg38 Position: ChrY:17010998..17010998
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1501_F TGTAACAATCATCACTCCCCTTC
Reverse Primer: A1501_R TGCCCTTAGAAATTCTGCATTC
Reviews

Customers who bought this product also purchased
A1507
A1507
A1488
A1488
A1498
A1498
A1506
A1506
A1496
A1496
A1503
A1503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies