Top » Catalog » R1b » A1502

$19.00

A1502
[A1502]

A1502
hg38 Position: ChrY:19044022..19044022
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1502_F AGCAGAGAGGAGGCTCACAG
Reverse Primer: A1502_R CAGCTGCTCCACTCTGACAC
Reviews

Customers who bought this product also purchased
A1494
A1494
A1500
A1500
A1509
A1509
A1491
A1491
A1499
A1499
A1507
A1507
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies