Top » Catalog » R1b » A46

$18.00

A46
[A46]

A46
hg38 Position: ChrY:13937911..13937911
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A46_F GCCGTACCTGTGAAGTATGCA
Reverse Primer: A46_R GCTACAGAGATAGGAACCACTTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
1 x A1077
1 x A291
1 x A391
1 x A91
1 x A1239
1 x A1500
1 x A2266
$180.00
Haplogroup Info
Other products
Currencies