Top » Catalog » R1b » A1507

$18.00

A1507
[A1507]

A1507
hg38 Position: ChrY:21034723..21034723
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1507_F CCACCACCCTTGTCCATAAC
Reverse Primer: A1507_R ACTGCAGCCTGGGTAACAAC
Reviews

Customers who bought this product also purchased
A1509
A1509
A1491
A1491
A1499
A1499
A1506
A1506
A1488
A1488
A1498
A1498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A2268
1 x A752
$54.00
Haplogroup Info
Other products
Currencies