Top » Catalog » R1b » A1509

$18.00

A1509
[A1509]

A1509
hg38 Position: ChrY:21475967..21475967
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1509_F CAACCTAGTTTATAGAAGATATTCGATTTTC
Reverse Primer: A1509_R CATTGTCTAAATGTGATTGACATCATC
Reviews

Customers who bought this product also purchased
A1496
A1496
A1502
A1502
A1495
A1495
A1501
A1501
BY23977
BY23977
A1494
A1494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A348
1 x A990
1 x A640
$54.00
Haplogroup Info
Other products
Currencies