Top » Catalog » R1b » A1511

$18.00

A1511
[A1511]

A1511
hg38 Position: ChrY:20937675..20937675
Ancestral: G
Derived: T
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4466 > A664
Forward Primer: A1511_F GGTGGATAACTTCAGTACCTCATTG
Reverse Primer: A1511_R CCACGTTTGTCTAGTTTCTAAGTTTG
Reviews

Customers who bought this product also purchased
BY2880
BY2880
A150
A150
S1121
S1121
A804
A804
A923
A923
A195
A195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1717
1 x A133
1 x A805
1 x A895
1 x A966
$90.00
Haplogroup Info
Other products
Currencies