Top » Catalog » R1b » A1511

$18.00

A1511
[A1511]

A1511
hg38 Position: ChrY:20937675..20937675
Ancestral: G
Derived: T
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4466 > A664
Forward Primer: A1511_F GGTGGATAACTTCAGTACCTCATTG
Reverse Primer: A1511_R CCACGTTTGTCTAGTTTCTAAGTTTG
Reviews

Customers who bought this product also purchased
A150
A150
BY2880
BY2880
FGC29280
FGC29280
Z17981
Z17981
Z16521
Z16521
A2221
A2221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
$108.00
Haplogroup Info
Other products
Currencies