Top » Catalog » R1b » A1511

$18.00

A1511
[A1511]

A1511
hg38 Position: ChrY:20937675..20937675
Ancestral: G
Derived: T
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4466 > A664
Forward Primer: A1511_F GGTGGATAACTTCAGTACCTCATTG
Reverse Primer: A1511_R CCACGTTTGTCTAGTTTCTAAGTTTG
Reviews

Customers who bought this product also purchased
A150
A150
BY2880
BY2880
A195
A195
A159
A159
A664
A664
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies