Top » Catalog » R1b » A1512

$18.00

A1512
[A1512]

A1512
hg38 Position: ChrY:6937260..6937263
Ancestral: ins
Derived: del
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4466 > A664
Forward Primer: A1512_F TGCCTTCATCGGTTTACTCC
Reverse Primer: A1512_R TGGAGTCTCACTCTGTCACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A883
$18.00
Haplogroup Info
Other products
Currencies