Top » Catalog » R1b » A48

$18.00

A48
[A48]

A48
hg38 Position: ChrY:21214492..21214492
Ancestral: G
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A48_F ATTTCTTTTGGCTCCTGACC
Reverse Primer: A48_R ACTCTTTTTAGCCCGCAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
1 x A935
1 x A159
1 x A312
1 x A2269
$324.00
Haplogroup Info
Other products
Currencies