Top » Catalog » R1b » A1537

$18.00

A1537
[A1537]

A1537
hg38 Position: ChrY:14325179..14325179
Ancestral: C
Derived: T
Reference: Gary Blakely (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2 (not listed)
Comments: Downstream S11477
Forward Primer: A1537_F CAACATGAAAATCACACTGATAGTTATG
Reverse Primer: A1537_R CATGACCCATCCGCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1251
$18.00
Haplogroup Info
Other products
Currencies