Top » Catalog » R1b » A5

$18.00

A5
[A5]

A5
hg38 Position: ChrY:13728439..13728439
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a
Comments: Found in a R1b-L513 person
Forward Primer: A5_F CACTCCCACTGTTTGAATGG
Reverse Primer: A5_R ATCACTGGCCCCATTAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
1 x A1077
1 x A291
1 x A391
1 x A91
1 x A1239
1 x A1500
1 x A2266
1 x A137
1 x A611
1 x A589
1 x A956
1 x A1335
1 x A88
1 x A1281
1 x A311
1 x A1312
1 x A774
$360.00
Haplogroup Info
Other products
Currencies