Top » Catalog » R1b » A50

$18.00

A50
[A50]

A50
hg38 Position: ChrY:7392954..7392954
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A50_F CAACTTAGGGGCTCATCTGG
Reverse Primer: A50_R CCCTGTCTTACCTGTCATTTCC
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
FGC23380
FGC23380
S7858
S7858
Z3004
Z3004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies