Top » Catalog » R1b » A50

$18.00

A50
[A50]

A50
hg38 Position: ChrY:7392954..7392954
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A50_F CAACTTAGGGGCTCATCTGG
Reverse Primer: A50_R CCCTGTCTTACCTGTCATTTCC
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
S971
S971
A57
A57
R1b-DF21 Panel
R1b-DF21 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies