Top » Catalog » R1b » A50

$18.00

A50
[A50]

A50
hg38 Position: ChrY:7392954..7392954
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A50_F CAACTTAGGGGCTCATCTGG
Reverse Primer: A50_R CCCTGTCTTACCTGTCATTTCC
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
A58
A58
Z16266
Z16266
S971
S971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies