Top » Catalog » R1b » A51

$18.00

A51
[A51]

A51
hg38 Position: ChrY:8816775..8816775
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A51_F CAAGACCTTGCCATAAGTGATAGA
Reverse Primer: A51_R AGCAGATGATTATTAACCATCTATACTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies