Top » Catalog » R1b » A54

$18.00

A54
[A54]

A54
hg38 Position: ChrY:12602498..12602498
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A54_F AGTGTATAGTCCTACTGCAAAGAGTATGA
Reverse Primer: A54_R TTACAAAATGACAATAGTCTGGCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
$18.00
Haplogroup Info
Other products
Currencies