Top » Catalog » R1b » A54

$18.00

A54
[A54]

A54
hg38 Position: ChrY:12602498..12602498
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A54_F AGTGTATAGTCCTACTGCAAAGAGTATGA
Reverse Primer: A54_R TTACAAAATGACAATAGTCTGGCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A965
1 x A315
1 x A170
1 x A2137
1 x A1277
1 x A799
1 x A181
1 x A1723
1 x A2268
1 x A655
1 x A94
1 x A298
1 x A1496
1 x A546
1 x A216
1 x A133
1 x A1133
1 x A1716
1 x A1502
1 x A438
1 x A899
1 x A353
1 x A1512
$414.00
Haplogroup Info
Other products
Currencies