Top » Catalog » R1b » A55

$18.00

A55
[A55]

A55
hg38 Position: ChrY:13203680..13203680
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A55_F ATTATGTATACGCATATAGTGCATTCTTCC
Reverse Primer: A55_R TGGAGTGCAAACTAAATTGAGCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies