Top » Catalog » R1b » A57

$18.00

A57
[A57]

A57
hg38 Position: ChrY:15002414..15002414
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Below DF21 > S971. Z3017
Forward Primer: A57_F CTTTGGGCCCTCTCCTACTC
Reverse Primer: A57_R TGGAACCCAAGTCAAGGAAG
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
S971
S971
A50
A50
R1b-DF21 Panel
R1b-DF21 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies