Top » Catalog » R1b » A57

$18.00

A57
[A57]

A57
hg38 Position: ChrY:15002414..15002414
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Below DF21 > S971. Z3017
Forward Primer: A57_F CTTTGGGCCCTCTCCTACTC
Reverse Primer: A57_R TGGAACCCAAGTCAAGGAAG
Reviews

Customers who bought this product also purchased
FGC3213
FGC3213
S5488
S5488
DF5
DF5
A58
A58
Z16266
Z16266
S971
S971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies