Top » Catalog » R1b » A58

$18.00

A58
[A58]

A58
hg38 Position: ChrY:15981609..15981609
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A58_F TCTACCCGAAGTTAAAGGGGAG
Reverse Primer: A58_R CCCTCTTTTTGGGTTTGTCA
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
R1b-DF21 Panel
R1b-DF21 Panel
A57
A57
FGC23380
FGC23380
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies