Top » Catalog » R1b » A59

$18.00

A59
[A59]

A59
hg38 Position: ChrY:16058526..16058526
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A59_F TGGCAGAAAAGGAATAACAGG
Reverse Primer: A59_R GCCATTGGGCTAAAAATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies