Top » Catalog » R1b » A60

$18.00

A60
[A60]

A60
hg38 Position: ChrY:16294089..16294089
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A60_F TCCCCTTTTTCTCACACACAC
Reverse Primer: A60_R CTATTTTGACAATCATTTTATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies