Top » Catalog » R1b » A60

$18.00

A60
[A60]

A60
hg38 Position: ChrY:16294089..16294089
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A60_F TCCCCTTTTTCTCACACACAC
Reverse Primer: A60_R CTATTTTGACAATCATTTTATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
1 x A93
1 x A136
1 x A101
1 x A92
1 x A135
1 x A43
1 x A60
1 x A3
1 x A133
1 x A162
1 x A151
1 x A81
1 x A146
1 x A132
1 x A167
1 x A33
1 x A6
1 x A58
1 x A99
1 x A131
1 x A149
1 x A77
1 x A109
1 x A163
1 x A179
1 x A57
1 x A130
1 x A161
1 x A50
1 x A71
$702.00
Haplogroup Info
Other products
Currencies