Top » Catalog » R1b » A60

$18.00

A60
[A60]

A60
hg38 Position: ChrY:16294089..16294089
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A60_F TCCCCTTTTTCTCACACACAC
Reverse Primer: A60_R CTATTTTGACAATCATTTTATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
1 x A935
$270.00
Haplogroup Info
Other products
Currencies