Top » Catalog » R1b » A61

$18.00

A61
[A61]

A61
hg38 Position: ChrY:19121587..19121587
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A61_F CCATAGCATGGAAAGGAAGC
Reverse Primer: A61_R AGACGAGGAGGGAAAAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
1 x A594
$126.00
Haplogroup Info
Other products
Currencies