Top » Catalog » R1b » A7

$18.00

A7
[A7]

A7
hg38 Position: ChrY:15735830..15735830
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b
Comments: Found in a R1b-L513 person
Forward Primer: A7_F TGCGTTACATGTGCACAATGTAG
Reverse Primer: A7_R ATTATAAATCCTTTCCTTTGTAAATCTATCCT
Reviews

Customers who bought this product also purchased
FGC32805
FGC32805
BY2598
BY2598
Z17816
Z17816
Z39589
Z39589
L577
L577
Z18492
Z18492
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies