Top » Catalog » R1b » A7

$18.00

A7
[A7]

A7
hg38 Position: ChrY:15735830..15735830
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b
Comments: Found in a R1b-L513 person
Forward Primer: A7_F TGCGTTACATGTGCACAATGTAG
Reverse Primer: A7_R ATTATAAATCCTTTCCTTTGTAAATCTATCCT
Reviews

Customers who bought this product also purchased
FGC32836
FGC32836
FGC32842
FGC32842
Z17294
Z17294
Z17296
Z17296
FGC32837
FGC32837
FGC32805
FGC32805
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies